Archives
br Materials and methods Adult Cebus apella males from
Materials and methods
Adult Cebus apella males from the Tufted Capuchin Procreation Center (UNESP, Campus Araçatuba) were housed in the same conditions, in individual cages and subjected to natural light-dark (LD) cycles. Eleven monkeys were sacrificed at different times (one animal at each time point) on different days (first day: 8:45, 11:30, 14:05; second day: 8:35, 10:30; third day: 16:00, 20:45, 00:30, 4:40; fourth day: 00:25, 4:30). The procedures for animal sedation were performed under red light during the dark phase. Samples of atrium, intestine, liver, lung, muscle and spleen were collected and frozen immediately in dry ice and stored at −80°C. All experimental protocols of animal used in this study were approved by the Research Committee of the Universidade Federal de São Paulo.
Total RNA was extracted from aforementioned tissues by using a Trizol-based extraction method according to the manufacturer\'s instructions (Invitrogen, Brazil). Total RNA concentrations were determined by using a spectrophotometer (NanoDrop 8000 Thermo Fisher Scientific), and the quality of RNA samples was assessed by electrophoresis on 1% agarose gels. Total RNA was subsequently treated with DNase I (Invitrogen, Brazil). 1.5µg of RNA from intestine, liver, lung, muscle and spleen, and 400ng of RNA from atrium samples were reverse transcribed using SuperScript First-Strand Synthesis for RT-PCR (Invitrogen, Brazil) according to the manufacturer\'s protocols.
Relative real-time PCR was performed using an ABI PRISM 7500 (Applied Biosystems). The primers were designed with Primer Premier 5 software (PREMIER Biosoft International), and the sequences of the forward and reverse primers were as follows: hPer3 FW: CAGGCTAACCAGGAATATTACCAGC, hPer3 RV: CACAGCCACAGAGAA GGTGTCCTGG; and the β-actin primers that were used as the endogenous control were β-actin FW: AGGTATCCTGACCCTGAAG, β-actin RV: CGTTGAAGGTCTCAAACATG. Control PCRs were performed using PCR reaction mixes without cDNA (non-template control) and with a cDNA sample without DNase I treatment.
The Cosinor method was used to verify whether the Per3 gene bcl-2 inhibitor presented a significant 24-h rhythm in different tissues. The level of significance for detection of the rhythmic cycle was set at р≤0.05.
Results
Per3 expression oscillated over the time period of 24h in all of the tissues studied. However, significant circadian rhythms were identified only in the liver and muscle according to the Cosinor analysis (with adjusted p-values of 0.046 and 0.028, respectively). The acrophases of Per3 expression in muscle and liver tissues were 5:58a.m. and 7:20a.m., respectively, and the phase angle between these two acrophases is 1h and 22min.
The observation of our results reveals that Per3 gene expression in almost all tissues present the highest level at the end of night and the beginning of morning, although in the spleen, the highest expression level occurs in the middle of night. The lowest level of expression was observed at dusk in the liver and atrium. In the intestine, lung, spleen and muscle, the minimum level of expression occurred in the middle of the afternoon (Fig. 1).
Discussion
It has been reported that the expression of several clock genes of different tissues of rodents, such as heart, lung, liver, stomach, spleen, kidney, pancreas, retina, bone marrow, submandibular gland and skeletal muscle exhibits a circadian pattern [48–57]. On the other hand, testis and thymus appear to have no oscillating pattern of the expression of clock genes [58,59]. In humans, most studies have shown robust circadian expression of clock genes in peripheral blood and tumor cells [23,24,60,61]. However, to date, there are few studies on the expression of clock genes in peripheral tissues of primates [62].
Although we were able to show that Per3 is expressed in six different tissues of a non-human primate (cap
uchin monkey), our study has some limitations: the data were collected from only one animal at a time, thus increasing the effects of individual variability, and we collected the samples for only one period of 24h. In spite of these limitations, it was possible to observe circadian expression of the Per3 gene in the liver and muscle, which indicates that the 24-h oscillation is clearly detectable.